../../tmp/servers/virsirnadb/548178068
Result for your query siRNA sequence
RED | =100 % Complementary sequence |
. | =Identical residue |
blue alphabets | =mismatch |
_ | =Gap |
Acc number | Strain name | Start | Alignment | End | % Identity |
Query | virsi2354 | 1 | gacactgagacaccaattgac | 21 | |
D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 7983 | ..................... | 8003 | 100 |
D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 7983 | ..................... | 8003 | 100 |
M84754.1 | HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome | 7983 | ..................... | 8003 | 100 |
U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 7984 | ..................... | 8004 | 100 |
D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 7983 | ..................... | 8003 | 100 |
D63857.1 | HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein | 7890 | ..................... | 7910 | 100 |
D50485.1 | HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g | 7971 | ..................... | 7991 | 100 |
D50481.1 | HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g | 7971 | ..................... | 7991 | 100 |
D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 7983 | ..................... | 8003 | 100 |
D85516.1 | Hepatitis C virus genomic RNA, complete cds | 7983 | ..................... | 8003 | 100 |
AJ132997.1 | Hepatitis C virus, complete genome, isolate HCV-AD78P1 | 7982 | ..................... | 8002 | 100 |
AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 7983 | ..................... | 8003 | 100 |
AF176573.1 | Hepatitis C virus subtype 1b strain 274933RU, complete genome | 7983 | ..................... | 8003 | 100 |
AJ238800.1 | Hepatitis C virus type 1b complete genome, isolate NC1 | 7642 | ..................... | 7662 | 100 |
AF165047.1 | Hepatitis C virus subtype 1b strain MD2-1, complete genome | 7971 | ..................... | 7991 | 100 |
AF165048.1 | Hepatitis C virus subtype 1b strain MD2-2, complete genome | 7971 | ..................... | 7991 | 100 |
AF165051.1 | Hepatitis C virus subtype 1b strain MD4-1, complete genome | 7971 | ..................... | 7991 | 100 |
AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 7971 | ..................... | 7991 | 100 |
AF165056.1 | Hepatitis C virus subtype 1b strain MD6-2, complete genome | 7980 | ..................... | 8000 | 100 |
AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 7971 | ..................... | 7991 | 100 |
AF165063.1 | Hepatitis C virus subtype 1b strain MD10-1, complete genome | 7971 | ..................... | 7991 | 100 |
AF165064.1 | Hepatitis C virus subtype 1b strain MD10-2, complete genome | 7971 | ..................... | 7991 | 100 |
AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 7965 | ..................... | 7985 | 100 |
AF207752.1 | Hepatitis C virus subtype 1b strain MD11, complete genome | 7971 | ..................... | 7991 | 100 |
AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 7971 | ..................... | 7991 | 100 |
AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 7980 | ..................... | 8000 | 100 |
AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 7971 | ..................... | 7991 | 100 |
AF207769.1 | Hepatitis C virus subtype 1b strain MD28, complete genome | 7971 | ..................... | 7991 | 100 |
AF207770.1 | Hepatitis C virus subtype 1b strain MD29, complete genome | 7971 | ..................... | 7991 | 100 |
AF207772.1 | Hepatitis C virus subtype 1b strain MD31, complete genome | 7971 | ..................... | 7991 | 100 |
AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 7985 | ..................... | 8005 | 100 |
AB080299.1 | Hepatitis C virus genomic RNA, complete genome, isolate:M1LE | 7983 | ..................... | 8003 | 100 |
AY460204.1 | Hepatitis C virus from Shanghai, complete genome | 7986 | ..................... | 8006 | 100 |
AB154177.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154178.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154179.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154180.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154183.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154185.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154186.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154194.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ..................... | 7991 | 100 |
AB249644.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 7983 | ..................... | 8003 | 100 |
EF638081.1 | Hepatitis C virus subtype 1b from Hubei, complete genome | 7939 | ..................... | 7959 | 100 |
EF407469.1 | Hepatitis C virus isolate 4014 polyprotein gene, complete cds | 7927 | ..................... | 7947 | 100 |
EF407471.1 | Hepatitis C virus isolate 5044 polyprotein gene, complete cds | 7928 | ..................... | 7948 | 100 |
EF407472.1 | Hepatitis C virus isolate 4034 polyprotein gene, complete cds | 7929 | ..................... | 7949 | 100 |
EF407475.1 | Hepatitis C virus isolate 3009 polyprotein gene, complete cds | 7915 | ..................... | 7935 | 100 |
EF407476.1 | Hepatitis C virus isolate 3012 polyprotein gene, complete cds | 7918 | ..................... | 7938 | 100 |
EF407479.1 | Hepatitis C virus isolate 4036 polyprotein gene, complete cds | 7934 | ..................... | 7954 | 100 |
EF407485.1 | Hepatitis C virus isolate 7026 polyprotein gene, complete cds | 7938 | ..................... | 7958 | 100 |
EF407493.1 | Hepatitis C virus isolate 3031 polyprotein gene, complete cds | 7935 | ..................... | 7955 | 100 |
EU234061.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet | 7931 | ..................... | 7951 | 100 |
EU234062.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet | 7931 | ..................... | 7951 | 100 |
EU155217.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet | 7931 | ..................... | 7951 | 100 |
EU155221.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet | 7931 | ..................... | 7951 | 100 |
EU155223.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet | 7937 | ..................... | 7957 | 100 |
EU155224.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet | 7931 | ..................... | 7951 | 100 |
EU155229.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet | 7931 | ..................... | 7951 | 100 |
EU155231.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet | 7931 | ..................... | 7951 | 100 |
EU155234.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet | 7935 | ..................... | 7955 | 100 |
EU482860.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet | 7931 | ..................... | 7951 | 100 |
EU482874.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet | 7934 | ..................... | 7954 | 100 |
EU482875.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet | 7931 | ..................... | 7951 | 100 |
EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 7937 | ..................... | 7957 | 100 |
EU482879.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet | 7934 | ..................... | 7954 | 100 |
EU482888.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet | 7934 | ..................... | 7954 | 100 |
EU155255.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet | 7937 | ..................... | 7957 | 100 |
EU155256.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet | 7931 | ..................... | 7951 | 100 |
EU155262.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet | 7931 | ..................... | 7951 | 100 |
EU155264.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V385/2006, complet | 7909 | ..................... | 7929 | 100 |
EU155279.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V441/2001, complet | 7931 | ..................... | 7951 | 100 |
EU155280.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet | 7931 | ..................... | 7951 | 100 |
EU155300.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet | 7930 | ..................... | 7950 | 100 |
EU155303.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet | 7931 | ..................... | 7951 | 100 |
EU155304.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V347/2003, complet | 7660 | ..................... | 7680 | 100 |
EU155331.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet | 7931 | ..................... | 7951 | 100 |
EU155335.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet | 7931 | ..................... | 7951 | 100 |
EU155357.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet | 7931 | ..................... | 7951 | 100 |
EU155360.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet | 7931 | ..................... | 7951 | 100 |
EU155364.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V288/2006, complet | 7931 | ..................... | 7951 | 100 |
EU155366.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet | 7931 | ..................... | 7951 | 100 |
EU155368.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet | 7931 | ..................... | 7951 | 100 |
EU155369.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet | 7931 | ..................... | 7951 | 100 |
EU155370.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V300/2005, complet | 7931 | ..................... | 7951 | 100 |
EU155371.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V301/2005, complet | 7928 | ..................... | 7948 | 100 |
EU155372.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet | 7931 | ..................... | 7951 | 100 |
EU155377.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V313/2006, complet | 7931 | ..................... | 7951 | 100 |
AB426117.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 7983 | ..................... | 8003 | 100 |
AB435162.2 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 7983 | ..................... | 8003 | 100 |
AB429050.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 | 7983 | ..................... | 8003 | 100 |
EU255960.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet | 7931 | ..................... | 7951 | 100 |
EU256090.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V162/2002, complet | 7931 | ..................... | 7951 | 100 |
EU256092.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet | 7931 | ..................... | 7951 | 100 |
EU256099.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V348/2002, complet | 7931 | ..................... | 7951 | 100 |
EU256100.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V349/2002, complet | 7931 | ..................... | 7951 | 100 |
EU256103.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V418/2001, complet | 7928 | ..................... | 7948 | 100 |
EU256001.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet | 7931 | ..................... | 7951 | 100 |
EU256054.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V443/2001, complet | 7943 | ..................... | 7963 | 100 |
EU256078.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V284/2005, complet | 7933 | ..................... | 7953 | 100 |
EU256079.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V286/2005, complet | 7932 | ..................... | 7952 | 100 |
EU256081.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet | 7931 | ..................... | 7951 | 100 |
EU256083.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet | 7931 | ..................... | 7951 | 100 |
EU255962.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V140/1991, complet | 7649 | ..................... | 7669 | 100 |
EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 7983 | ..................... | 8003 | 100 |
FJ390396.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple | 7931 | ..................... | 7951 | 100 |
FJ390397.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple | 7931 | ..................... | 7951 | 100 |
FJ390398.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple | 7931 | ..................... | 7951 | 100 |
FJ478453.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple | 7931 | ..................... | 7951 | 100 |
AB442219.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 7983 | ..................... | 8003 | 100 |
AB442221.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 7983 | ..................... | 8003 | 100 |
EU862837.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet | 7938 | ..................... | 7958 | 100 |
D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 7971 | ...................._ | 7990 | 95 |
D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 7971 | ...................._ | 7990 | 95 |
AF207754.1 | Hepatitis C virus subtype 1b strain MD13, complete genome | 7971 | ...................._ | 7990 | 95 |
AB049094.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 7987 | ...................._ | 8006 | 95 |
AB191333.1 | Hepatitis C virus genomic RNA, complete genome, strain:0 | 7983 | ...................._ | 8002 | 95 |
EU482881.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet | 7940 | ...................._ | 7959 | 95 |
EU155254.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet | 7932 | ...................._ | 7951 | 95 |
EU155259.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet | 7931 | ...................._ | 7950 | 95 |
EU155308.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V354/2003, complet | 7931 | ...................._ | 7950 | 95 |
EU155318.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet | 7931 | ...................._ | 7950 | 95 |
EU155329.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet | 7931 | ...................._ | 7950 | 95 |
EU155330.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet | 7953 | ...................._ | 7972 | 95 |
EU155337.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet | 7931 | ...................._ | 7950 | 95 |
FJ024279.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple | 7931 | ...................._ | 7950 | 95 |
FN435993.1 | Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN | 7984 | ...................._ | 8003 | 95 |
X61596.1 | Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene | 7966 | ........a............ | 7986 | 95 |
D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 7983 | ........a............ | 8003 | 95 |
D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 7983 | ........a............ | 8003 | 95 |
M58335.1 | HPCHUMR Hepatitis C virus subtype 1b, complete genome | 7974 | .......t............. | 7994 | 95 |
S62220.1 | Hepatitis C virus subtype 1b, complete genome | 7994 | .......t............. | 8014 | 95 |
D10934.1 | HPCRNA Hepatitis C virus RNA, complete genome sequence | 7983 | ........a............ | 8003 | 95 |
D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 7983 | ......a.............. | 8003 | 95 |
AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 7983 | ........a............ | 8003 | 95 |
AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 7983 | ........a............ | 8003 | 95 |
AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 7984 | ........a............ | 8004 | 95 |
AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 7973 | ........a............ | 7993 | 95 |
AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 7988 | ........a............ | 8008 | 95 |
AF165060.1 | Hepatitis C virus subtype 1b strain MD8-2, complete genome | 7971 | ..............c...... | 7991 | 95 |
AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 7971 | ....a................ | 7991 | 95 |
AF165062.1 | Hepatitis C virus subtype 1b strain MD9-2, complete genome | 7971 | ....a................ | 7991 | 95 |
AF207753.1 | Hepatitis C virus subtype 1b strain MD12, complete genome | 7971 | ..................a.. | 7991 | 95 |
AF207761.1 | Hepatitis C virus subtype 1b strain MD20, complete genome | 7971 | ...t................. | 7991 | 95 |
AF207764.1 | Hepatitis C virus subtype 1b strain MD23, complete genome | 7971 | ........a............ | 7991 | 95 |
AF207768.1 | Hepatitis C virus subtype 1b strain MD27, complete genome | 7971 | ........a............ | 7991 | 95 |
AB049089.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10 | 7952 | ........c............ | 7972 | 95 |
AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 7952 | ......c.............. | 7972 | 95 |
AB049091.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 7901 | ........a............ | 7921 | 95 |
AB049093.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15 | 7952 | ........c............ | 7972 | 95 |
AB049096.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 7952 | .......t............. | 7972 | 95 |
AB049097.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 7964 | ..................a.. | 7984 | 95 |
AB049099.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 7986 | .......t............. | 8006 | 95 |
AB049100.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 7952 | ....a................ | 7972 | 95 |
AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 7952 | ...............c..... | 7972 | 95 |
AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 7983 | .......t............. | 8003 | 95 |
AF356827.1 | Hepatitis C virus subtype 1b isolate HCV-S1, complete genome | 7983 | .................a... | 8003 | 95 |
AF139594.2 | Hepatitis C virus subtype 1b strain HCV-N, complete genome | 7998 | .......t............. | 8018 | 95 |
AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ........a............ | 7991 | 95 |
AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 7971 | ........a............ | 7991 | 95 |
EF032892.1 | Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge | 7959 | ........a............ | 7979 | 95 |
EF032893.1 | Hepatitis C virus subtype 1b isolate BR1427_P3_11.10.03 polyprotein g | 7957 | ........a............ | 7977 | 95 |
EF407460.1 | Hepatitis C virus isolate 8007 polyprotein gene, complete cds | 7933 | ........c............ | 7953 | 95 |
EF407470.1 | Hepatitis C virus isolate 4064 polyprotein gene, complete cds | 7935 | ........t............ | 7955 | 95 |
EF407480.1 | Hepatitis C virus isolate 3043 polyprotein gene, complete cds | 7930 | ........a............ | 7950 | 95 |
EF407487.1 | Hepatitis C virus isolate 6057 polyprotein gene, complete cds | 7930 | ......c.............. | 7950 | 95 |
EF407488.1 | Hepatitis C virus isolate 8016 polyprotein gene, complete cds | 7927 | ........a............ | 7947 | 95 |
EF407497.1 | Hepatitis C virus isolate 5002 polyprotein gene, complete cds | 7927 | .......t............. | 7947 | 95 |
EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 8012 | ......c.............. | 8032 | 95 |
EF407503.1 | Hepatitis C virus isolate 5083 polyprotein gene, complete cds | 7930 | ........c............ | 7950 | 95 |
EU155219.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet | 7931 | ........a............ | 7951 | 95 |
EU155222.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet | 7931 | ........a............ | 7951 | 95 |
EU155225.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet | 7932 | ........a............ | 7952 | 95 |
EU155226.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet | 7931 | ........c............ | 7951 | 95 |
EU155228.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet | 7931 | ........a............ | 7951 | 95 |
EU482833.1 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet | 7931 | ........a............ | 7951 | 95 |
EU482839.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet | 7931 | .................c... | 7951 | 95 |
EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 7931 | .......t............. | 7951 | 95 |
EU482859.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet | 7931 | ..............t...... | 7951 | 95 |
EU482880.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet | 7934 | ........t............ | 7954 | 95 |
EU482885.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet | 7934 | ...........t......... | 7954 | 95 |
EU482886.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet | 7935 | ..............g...... | 7955 | 95 |
EU155253.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet | 7934 | ..............g...... | 7954 | 95 |
EU155257.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet | 7931 | ...t................. | 7951 | 95 |
EU155258.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet | 7931 | ........a............ | 7951 | 95 |
EU155260.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet | 7931 | ....t................ | 7951 | 95 |
EU155261.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet | 7932 | ........a............ | 7952 | 95 |
EU155263.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet | 7931 | .......t............. | 7951 | 95 |
EU155301.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet | 7931 | ........a............ | 7951 | 95 |
EU155305.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet | 7931 | ........t............ | 7951 | 95 |
EU155306.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet | 7931 | ........a............ | 7951 | 95 |
EU155307.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V353/2002, complet | 7932 | ...t................. | 7952 | 95 |
EU155316.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet | 7931 | ...........g......... | 7951 | 95 |
EU155324.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet | 7931 | ...t................. | 7951 | 95 |
EU155326.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet | 7931 | ........a............ | 7951 | 95 |
EU155327.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V125/1992, complet | 7921 | ........c............ | 7941 | 95 |
EU155328.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet | 7931 | .................c... | 7951 | 95 |
EU155332.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet | 7931 | ........t............ | 7951 | 95 |
EU155333.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet | 7920 | ........a............ | 7940 | 95 |
EU155356.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet | 7931 | ........a............ | 7951 | 95 |
EU155359.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet | 7932 | ...............c..... | 7952 | 95 |
EU155361.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet | 7931 | ....g................ | 7951 | 95 |
EU155363.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet | 7931 | ........a............ | 7951 | 95 |
EU155373.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V307/2005, complet | 7931 | ........t............ | 7951 | 95 |
EU155376.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V311/2006, complet | 7931 | ...............c..... | 7951 | 95 |
EU155381.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V502/2004, complet | 7931 | ....a................ | 7951 | 95 |
EU529682.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V291/2002, complet | 7649 | ........a............ | 7669 | 95 |
EU660388.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet | 7932 | ........a............ | 7952 | 95 |
EU256059.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V220/2005, complet | 7931 | ..............g...... | 7951 | 95 |
EU256061.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet | 7931 | ........a............ | 7951 | 95 |
EU256062.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V368/2006, complet | 7934 | ........c............ | 7954 | 95 |
EU256064.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet | 7931 | ........c............ | 7951 | 95 |
EU256065.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet | 7931 | ........a............ | 7951 | 95 |
EU256088.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet | 7931 | ....a................ | 7951 | 95 |
EU256089.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet | 7931 | ........a............ | 7951 | 95 |
EU256045.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V380/2003, complet | 7931 | ........a............ | 7951 | 95 |
EU256075.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet | 7931 | ........a............ | 7951 | 95 |
EU256077.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V283/2005, complet | 7931 | ........a............ | 7951 | 95 |
EU256082.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet | 7932 | ........a............ | 7952 | 95 |
EU255961.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet | 7932 | ..............g...... | 7952 | 95 |
FJ024086.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1704/2007, comple | 7928 | .................c... | 7948 | 95 |
FJ024277.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple | 7931 | .....c............... | 7951 | 95 |
EU862835.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial | 7928 | ........a............ | 7948 | 95 |
FJ821465.1 | Hepatitis C virus strain M21-2k/1b, complete genome | 7969 | ........a............ | 7989 | 95 |
D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 7971 | ........a..........._ | 7990 | 90 |
D50482.1 | HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g | 7971 | ........a..........._ | 7990 | 90 |
D50484.1 | HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g | 7971 | ........a..........._ | 7990 | 90 |
D89872.1 | Hepatitis C virus RNA for polyprotein, complete cds | 7642 | ........a..........._ | 7661 | 90 |
AJ000009.1 | Hepatitis C virus complete genome sequence | 7966 | ........a..........._ | 7985 | 90 |
AF165055.1 | Hepatitis C virus subtype 1b strain MD6-1, complete genome | 7980 | .....c.............._ | 7999 | 90 |
AF207760.1 | Hepatitis C virus subtype 1b strain MD19, complete genome | 7971 | ..................c._ | 7990 | 90 |
AF483269.1 | Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom | 7948 | .................c.._ | 7967 | 90 |
AY587844.1 | Hepatitis C virus strain N589 polyprotein gene, complete cds | 7931 | ........t..........._ | 7950 | 90 |
EF407465.1 | Hepatitis C virus isolate 6017 polyprotein gene, complete cds | 7928 | ........a..........._ | 7947 | 90 |
EF407492.1 | Hepatitis C virus isolate 7025 polyprotein gene, complete cds | 7923 | ........a..........._ | 7942 | 90 |
EF407501.1 | Hepatitis C virus isolate 7055 polyprotein gene, complete cds | 7956 | ........c..........._ | 7975 | 90 |
EF407504.1 | Hepatitis C virus isolate 8069 polyprotein gene, complete cds | 7937 | ........c..........._ | 7956 | 90 |
EU155227.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V157/2003, complet | 7931 | ........a..........._ | 7950 | 90 |
EU155230.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet | 7931 | ........a..........._ | 7950 | 90 |
EU155336.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet | 7931 | ........c..........._ | 7950 | 90 |
EU155375.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V309/2006, complet | 7931 | ........a..........._ | 7950 | 90 |
EU660386.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet | 7931 | .......t............_ | 7950 | 90 |
EU256098.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet | 7946 | ..............g....._ | 7965 | 90 |
EU256101.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V351/2002, complet | 7931 | ..............g....._ | 7950 | 90 |
EU256102.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet | 7931 | ..................c._ | 7950 | 90 |
EU256000.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet | 7931 | ........c..........._ | 7950 | 90 |
U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 7983 | ....a..t............. | 8003 | 90 |
AF165045.1 | Hepatitis C virus subtype 1b strain MD1-1, complete genome | 7971 | ......c.a............ | 7991 | 90 |
AF165046.1 | Hepatitis C virus subtype 1b strain MD1-2, complete genome | 7971 | ......c.a............ | 7991 | 90 |
AF165054.1 | Hepatitis C virus subtype 1b strain MD5-2, complete genome | 7971 | ........a.........a.. | 7991 | 90 |
AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 7971 | ...c....a............ | 7991 | 90 |
AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 7971 | ...c....a............ | 7991 | 90 |
AF207757.1 | Hepatitis C virus subtype 1b strain MD16, complete genome | 7971 | ....a..t............. | 7991 | 90 |
AF207762.1 | Hepatitis C virus subtype 1b strain MD21, complete genome | 7971 | ..............g...a.. | 7991 | 90 |
AF207773.1 | Hepatitis C virus subtype 1b strain MD32, complete genome | 7971 | .....c..a............ | 7991 | 90 |
AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 7983 | ...t....a............ | 8003 | 90 |
AB049095.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 7952 | ...c....a............ | 7972 | 90 |
AY587845.1 | Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c | 7922 | ....t...a............ | 7942 | 90 |
DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 7983 | ...t..c.............. | 8003 | 90 |
EF407461.1 | Hepatitis C virus isolate 5004 polyprotein gene, complete cds | 7963 | .......ta............ | 7983 | 90 |
EF407482.1 | Hepatitis C virus isolate 6053 polyprotein gene, complete cds | 7868 | ....a...a............ | 7888 | 90 |
EU155232.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet | 7932 | ....a..t............. | 7952 | 90 |
EU155302.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet | 7931 | .....c..a............ | 7951 | 90 |
EU155315.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet | 7931 | ........c..c......... | 7951 | 90 |
EU155317.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet | 7931 | .....ac.............. | 7951 | 90 |
EU155334.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet | 7931 | ...c....t............ | 7951 | 90 |
EU155358.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet | 7931 | ....g...a............ | 7951 | 90 |
EU155374.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V308/2005, complet | 7953 | ....a...t............ | 7973 | 90 |
EU155382.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V504/2003, complet | 7937 | ...t....a............ | 7957 | 90 |
EU256066.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V382/2003, complet | 7932 | ...t....a............ | 7952 | 90 |
EU256076.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V280/2004, complet | 7931 | ....a...a............ | 7951 | 90 |
EU256080.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V292/2002, complet | 7931 | .......ta............ | 7951 | 90 |
AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 7983 | ...g....a............ | 8003 | 90 |
GU133617.1 | Hepatitis C virus subtype 1b, complete genome | 7983 | .......ca............ | 8003 | 90 |
AF207765.1 | Hepatitis C virus subtype 1b strain MD24, complete genome | 7971 | .................____ | 7987 | 80 |
AF207767.1 | Hepatitis C virus subtype 1b strain MD26, complete genome | 7971 | .................____ | 7987 | 80 |
D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 7983 | ........c.........c._ | 8002 | 85 |
AF207755.1 | Hepatitis C virus subtype 1b strain MD14, complete genome | 7971 | ......c.a..........._ | 7990 | 85 |
AB049092.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 7952 | ........a.........c._ | 7971 | 85 |
EU155235.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet | 7931 | .....c..c..........._ | 7950 | 85 |
EU256091.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V455/2006, complet | 7649 | ...t....c..........._ | 7668 | 85 |
EU256084.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet | 7937 | .......t.........c.._ | 7956 | 85 |
M96362.1 | HPCUNKCDS Hepatitis C virus mRNA, complete cds | 7984 | ........a.........___ | 8001 | 80 |
U16362.1 | HCU16362 Hepatitis C virus subtype 1b, complete genome | 7984 | ........a.........___ | 8001 | 80 |
AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 7971 | ........a.........___ | 7988 | 80 |
AF207763.1 | Hepatitis C virus subtype 1b strain MD22, complete genome | 7971 | ........c.........___ | 7988 | 80 |
U89019.1 | HCU89019 Hepatitis C virus subtype 1b, complete genome | 7972 | ...t..c..........c... | 7992 | 85 |
AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 7952 | ......ata............ | 7972 | 85 |
EU362890.1 | Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c | 7945 | ....g..t.........a... | 7965 | 85 |
EU155267.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V391/2006, complet | 7892 | ....g..t.........a... | 7912 | 85 |
EU155271.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V401/2006, complet | 7908 | ....g..t.........a... | 7928 | 85 |
EU155281.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet | 7931 | .....ca.t............ | 7951 | 85 |
EU155287.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V320/2001, complet | 7941 | ....g..t.........a... | 7961 | 85 |
EU256028.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V84/2001, complete | 7912 | ....g..t.........a... | 7932 | 85 |
FJ024281.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1718/2007, comple | 7910 | ....g..t.........a... | 7930 | 85 |
EU862826.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V198/1989, partial | 7903 | ....g..t.........a... | 7923 | 85 |
FJ410172.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1746/2008, comple | 7880 | ....g..t.........a... | 7900 | 85 |
EU862838.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V165/1992, complet | 7920 | ....g..t.........a... | 7940 | 85 |
L02836.1 | HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome | 7972 | ....a............____ | 7988 | 76 |
EU239714.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet | 7932 | ......act..........._ | 7951 | 80 |
EU155362.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet | 7931 | ...g....a.........c._ | 7950 | 80 |
EU255928.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V231/2003, complet | 7912 | ....g..t.........a.._ | 7931 | 80 |
EU256053.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V440/2001, complet | 7913 | ....g..t.........a.._ | 7932 | 80 |
D00944.1 | HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds | 8051 | .....ac.a.........___ | 8068 | 71 |
AB047642.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 | 8051 | ...t.ac...........___ | 8068 | 71 |
DQ835763.1 | Hepatitis C virus subtype 6m isolate C-0208, complete genome | 7998 | ....a.c.a.........___ | 8015 | 71 |
DQ835768.1 | Hepatitis C virus subtype 6n isolate D86/93, complete genome | 7995 | ....a.c.a.........___ | 8012 | 71 |
FJ407092.1 | Hepatitis C virus isolate IND-HCV-3i, complete genome | 8015 | ......acc.........___ | 8032 | 71 |
AF177036.1 | Hepatitis C virus subtype 2a strain HC-J6CH clone pJ6CF, complete gen | 8051 | ...t.a..a.........___ | 8068 | 71 |
FJ462438.1 | Hepatitis C virus isolate QC383, complete genome | 8760 | ...c.........._______ | 8773 | 61 |