../../tmp/servers/virsirnadb/548178068
Result for your query siRNA sequence
RED =100 % Complementary sequence
.=Identical residue
blue alphabets=mismatch
_=Gap


Acc numberStrain nameStartAlignmentEnd% Identity
Queryvirsi23541gacactgagacaccaattgac21
D11168.1HPCJTA Hepatitis C virus (HCV) complete genome 7983.....................8003100
D11355.1HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' 7983.....................8003100
M84754.1HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome7983.....................8003100
U01214.1HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome 7984.....................8004100
D30613.1HPCPP Hepatitis C virus complete genome sequence 7983.....................8003100
D63857.1HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein7890.....................7910100
D50485.1HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g7971.....................7991100
D50481.1HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g7971.....................7991100
D45172.1HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd7983.....................8003100
D85516.1 Hepatitis C virus genomic RNA, complete cds 7983.....................8003100
AJ132997.1 Hepatitis C virus, complete genome, isolate HCV-AD78P1 7982.....................8002100
AJ238799.1 Hepatitis C virus type 1b complete genome, isolate Con1 7983.....................8003100
AF176573.1 Hepatitis C virus subtype 1b strain 274933RU, complete genome 7983.....................8003100
AJ238800.1 Hepatitis C virus type 1b complete genome, isolate NC1 7642.....................7662100
AF165047.1 Hepatitis C virus subtype 1b strain MD2-1, complete genome 7971.....................7991100
AF165048.1 Hepatitis C virus subtype 1b strain MD2-2, complete genome 7971.....................7991100
AF165051.1 Hepatitis C virus subtype 1b strain MD4-1, complete genome 7971.....................7991100
AF165052.1 Hepatitis C virus subtype 1b strain MD4-2, complete genome 7971.....................7991100
AF165056.1 Hepatitis C virus subtype 1b strain MD6-2, complete genome 7980.....................8000100
AF165059.1 Hepatitis C virus subtype 1b strain MD8-1, complete genome 7971.....................7991100
AF165063.1 Hepatitis C virus subtype 1b strain MD10-1, complete genome 7971.....................7991100
AF165064.1 Hepatitis C virus subtype 1b strain MD10-2, complete genome 7971.....................7991100
AF208024.1 Hepatitis C virus subtype 1b strain MD34, complete genome 7965.....................7985100
AF207752.1 Hepatitis C virus subtype 1b strain MD11, complete genome 7971.....................7991100
AF207756.1 Hepatitis C virus subtype 1b strain MD15, complete genome 7971.....................7991100
AF207759.1 Hepatitis C virus subtype 1b strain MD18, complete genome 7980.....................8000100
AF207766.1 Hepatitis C virus subtype 1b strain MD25, complete genome 7971.....................7991100
AF207769.1 Hepatitis C virus subtype 1b strain MD28, complete genome 7971.....................7991100
AF207770.1 Hepatitis C virus subtype 1b strain MD29, complete genome 7971.....................7991100
AF207772.1 Hepatitis C virus subtype 1b strain MD31, complete genome 7971.....................7991100
AY045702.1 Hepatitis C virus isolate HCR6, complete genome 7985.....................8005100
AB080299.1 Hepatitis C virus genomic RNA, complete genome, isolate:M1LE 7983.....................8003100
AY460204.1 Hepatitis C virus from Shanghai, complete genome 7986.....................8006100
AB154177.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154178.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154179.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154180.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154181.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154182.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154183.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154185.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154186.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154187.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154189.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154190.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154191.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154192.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154194.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154198.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154199.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154200.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154205.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB154206.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971.....................7991100
AB249644.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 7983.....................8003100
EF638081.1 Hepatitis C virus subtype 1b from Hubei, complete genome 7939.....................7959100
EF407469.1 Hepatitis C virus isolate 4014 polyprotein gene, complete cds 7927.....................7947100
EF407471.1 Hepatitis C virus isolate 5044 polyprotein gene, complete cds 7928.....................7948100
EF407472.1 Hepatitis C virus isolate 4034 polyprotein gene, complete cds 7929.....................7949100
EF407475.1 Hepatitis C virus isolate 3009 polyprotein gene, complete cds 7915.....................7935100
EF407476.1 Hepatitis C virus isolate 3012 polyprotein gene, complete cds 7918.....................7938100
EF407479.1 Hepatitis C virus isolate 4036 polyprotein gene, complete cds 7934.....................7954100
EF407485.1 Hepatitis C virus isolate 7026 polyprotein gene, complete cds 7938.....................7958100
EF407493.1 Hepatitis C virus isolate 3031 polyprotein gene, complete cds 7935.....................7955100
EU234061.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet7931.....................7951100
EU234062.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet7931.....................7951100
EU155217.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet7931.....................7951100
EU155221.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet7931.....................7951100
EU155223.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet7937.....................7957100
EU155224.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet7931.....................7951100
EU155229.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet7931.....................7951100
EU155231.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet7931.....................7951100
EU155234.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet7935.....................7955100
EU482860.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet7931.....................7951100
EU482874.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet7934.....................7954100
EU482875.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet7931.....................7951100
EU482877.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet7937.....................7957100
EU482879.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet7934.....................7954100
EU482888.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet7934.....................7954100
EU155255.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet7937.....................7957100
EU155256.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet7931.....................7951100
EU155262.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet7931.....................7951100
EU155264.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V385/2006, complet7909.....................7929100
EU155279.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V441/2001, complet7931.....................7951100
EU155280.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet7931.....................7951100
EU155300.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V341/2003, complet7930.....................7950100
EU155303.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet7931.....................7951100
EU155304.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V347/2003, complet7660.....................7680100
EU155331.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet7931.....................7951100
EU155335.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet7931.....................7951100
EU155357.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet7931.....................7951100
EU155360.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet7931.....................7951100
EU155364.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V288/2006, complet7931.....................7951100
EU155366.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet7931.....................7951100
EU155368.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet7931.....................7951100
EU155369.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet7931.....................7951100
EU155370.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V300/2005, complet7931.....................7951100
EU155371.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V301/2005, complet7928.....................7948100
EU155372.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet7931.....................7951100
EU155377.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V313/2006, complet7931.....................7951100
AB426117.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 7983.....................8003100
AB435162.2 Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima 7983.....................8003100
AB429050.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 7983.....................8003100
EU255960.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet7931.....................7951100
EU256090.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V162/2002, complet7931.....................7951100
EU256092.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet7931.....................7951100
EU256099.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V348/2002, complet7931.....................7951100
EU256100.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V349/2002, complet7931.....................7951100
EU256103.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V418/2001, complet7928.....................7948100
EU256001.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet7931.....................7951100
EU256054.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V443/2001, complet7943.....................7963100
EU256078.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V284/2005, complet7933.....................7953100
EU256079.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V286/2005, complet7932.....................7952100
EU256081.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet7931.....................7951100
EU256083.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet7931.....................7951100
EU255962.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V140/1991, complet7649.....................7669100
EU857431.1 Hepatitis C virus subtype 1b isolate Whu, complete genome 7983.....................8003100
FJ390396.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple7931.....................7951100
FJ390397.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple7931.....................7951100
FJ390398.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple7931.....................7951100
FJ478453.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple7931.....................7951100
AB442219.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B-7983.....................8003100
AB442221.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH7983.....................8003100
EU862837.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet7938.....................7958100
D50483.1HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g7971...................._799095
D50480.1HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g7971...................._799095
AF207754.1 Hepatitis C virus subtype 1b strain MD13, complete genome 7971...................._799095
AB049094.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT167987...................._800695
AB191333.1 Hepatitis C virus genomic RNA, complete genome, strain:0 7983...................._800295
EU482881.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet7940...................._795995
EU155254.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet7932...................._795195
EU155259.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet7931...................._795095
EU155308.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V354/2003, complet7931...................._795095
EU155318.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet7931...................._795095
EU155329.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet7931...................._795095
EU155330.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet7953...................._797295
EU155337.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet7931...................._795095
FJ024279.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple7931...................._795095
FN435993.1 Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN7984...................._800395
X61596.1 Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene7966........a............798695
D13558.1HPCJ483 Hepatitis C virus genome, complete sequence 7983........a............800395
D10750.1HPCJ491 Hepatitis C virus genome, complete sequence 7983........a............800395
M58335.1HPCHUMR Hepatitis C virus subtype 1b, complete genome 7974.......t.............799495
S62220.1 Hepatitis C virus subtype 1b, complete genome 7994.......t.............801495
D10934.1HPCRNA Hepatitis C virus RNA, complete genome sequence 7983........a............800395
D14484.1HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome 7983......a..............800395
AF054247.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete7983........a............800395
AF054248.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete7983........a............800395
AF054249.1 Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete7984........a............800495
AF054250.1 Hepatitis C virus subtype 1b strain HC-J4, complete genome 7973........a............799395
AJ132996.1 Hepatitis C virus, complete genome, isolate HCV-AD78 7988........a............800895
AF165060.1 Hepatitis C virus subtype 1b strain MD8-2, complete genome 7971..............c......799195
AF165061.1 Hepatitis C virus subtype 1b strain MD9-1, complete genome 7971....a................799195
AF165062.1 Hepatitis C virus subtype 1b strain MD9-2, complete genome 7971....a................799195
AF207753.1 Hepatitis C virus subtype 1b strain MD12, complete genome 7971..................a..799195
AF207761.1 Hepatitis C virus subtype 1b strain MD20, complete genome 7971...t.................799195
AF207764.1 Hepatitis C virus subtype 1b strain MD23, complete genome 7971........a............799195
AF207768.1 Hepatitis C virus subtype 1b strain MD27, complete genome 7971........a............799195
AB049089.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT107952........c............797295
AB049090.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT147952......c..............797295
AB049091.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT147901........a............792195
AB049093.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT157952........c............797295
AB049096.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT197952.......t.............797295
AB049097.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT197964..................a..798495
AB049099.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT217986.......t.............800695
AB049100.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT217952....a................797295
AB049101.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT227952...............c.....797295
AF333324.1 Hepatitis C virus type 1b polyprotein mRNA, complete cds 7983.......t.............800395
AF356827.1 Hepatitis C virus subtype 1b isolate HCV-S1, complete genome 7983.................a...800395
AF139594.2 Hepatitis C virus subtype 1b strain HCV-N, complete genome 7998.......t.............801895
AB154201.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971........a............799195
AB154202.1 Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola7971........a............799195
EF032892.1 Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge7959........a............797995
EF032893.1 Hepatitis C virus subtype 1b isolate BR1427_P3_11.10.03 polyprotein g7957........a............797795
EF407460.1 Hepatitis C virus isolate 8007 polyprotein gene, complete cds 7933........c............795395
EF407470.1 Hepatitis C virus isolate 4064 polyprotein gene, complete cds 7935........t............795595
EF407480.1 Hepatitis C virus isolate 3043 polyprotein gene, complete cds 7930........a............795095
EF407487.1 Hepatitis C virus isolate 6057 polyprotein gene, complete cds 7930......c..............795095
EF407488.1 Hepatitis C virus isolate 8016 polyprotein gene, complete cds 7927........a............794795
EF407497.1 Hepatitis C virus isolate 5002 polyprotein gene, complete cds 7927.......t.............794795
EF407502.1 Hepatitis C virus isolate 2038 polyprotein gene, complete cds 8012......c..............803295
EF407503.1 Hepatitis C virus isolate 5083 polyprotein gene, complete cds 7930........c............795095
EU155219.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet7931........a............795195
EU155222.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet7931........a............795195
EU155225.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet7932........a............795295
EU155226.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet7931........c............795195
EU155228.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet7931........a............795195
EU482833.1 Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet7931........a............795195
EU482839.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet7931.................c...795195
EU482849.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet7931.......t.............795195
EU482859.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet7931..............t......795195
EU482880.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet7934........t............795495
EU482885.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet7934...........t.........795495
EU482886.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet7935..............g......795595
EU155253.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet7934..............g......795495
EU155257.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet7931...t.................795195
EU155258.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet7931........a............795195
EU155260.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet7931....t................795195
EU155261.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet7932........a............795295
EU155263.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet7931.......t.............795195
EU155301.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet7931........a............795195
EU155305.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet7931........t............795195
EU155306.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet7931........a............795195
EU155307.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V353/2002, complet7932...t.................795295
EU155316.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet7931...........g.........795195
EU155324.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet7931...t.................795195
EU155326.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet7931........a............795195
EU155327.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V125/1992, complet7921........c............794195
EU155328.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet7931.................c...795195
EU155332.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet7931........t............795195
EU155333.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V133/1989, complet7920........a............794095
EU155356.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet7931........a............795195
EU155359.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet7932...............c.....795295
EU155361.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet7931....g................795195
EU155363.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet7931........a............795195
EU155373.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V307/2005, complet7931........t............795195
EU155376.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V311/2006, complet7931...............c.....795195
EU155381.2 Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V502/2004, complet7931....a................795195
EU529682.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V291/2002, complet7649........a............766995
EU660388.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet7932........a............795295
EU256059.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V220/2005, complet7931..............g......795195
EU256061.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet7931........a............795195
EU256062.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V368/2006, complet7934........c............795495
EU256064.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet7931........c............795195
EU256065.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet7931........a............795195
EU256088.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet7931....a................795195
EU256089.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet7931........a............795195
EU256045.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V380/2003, complet7931........a............795195
EU256075.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet7931........a............795195
EU256077.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V283/2005, complet7931........a............795195
EU256082.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet7932........a............795295
EU255961.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet7932..............g......795295
FJ024086.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1704/2007, comple7928.................c...794895
FJ024277.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple7931.....c...............795195
EU862835.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial7928........a............794895
FJ821465.1 Hepatitis C virus strain M21-2k/1b, complete genome 7969........a............798995
D90208.1HPCJCG Hepatitis C virus ORF gene, complete cds 7971........a..........._799090
D50482.1HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g7971........a..........._799090
D50484.1HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g7971........a..........._799090
D89872.1 Hepatitis C virus RNA for polyprotein, complete cds 7642........a..........._766190
AJ000009.1 Hepatitis C virus complete genome sequence 7966........a..........._798590
AF165055.1 Hepatitis C virus subtype 1b strain MD6-1, complete genome 7980.....c.............._799990
AF207760.1 Hepatitis C virus subtype 1b strain MD19, complete genome 7971..................c._799090
AF483269.1 Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom7948.................c.._796790
AY587844.1 Hepatitis C virus strain N589 polyprotein gene, complete cds 7931........t..........._795090
EF407465.1 Hepatitis C virus isolate 6017 polyprotein gene, complete cds 7928........a..........._794790
EF407492.1 Hepatitis C virus isolate 7025 polyprotein gene, complete cds 7923........a..........._794290
EF407501.1 Hepatitis C virus isolate 7055 polyprotein gene, complete cds 7956........c..........._797590
EF407504.1 Hepatitis C virus isolate 8069 polyprotein gene, complete cds 7937........c..........._795690
EU155227.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V157/2003, complet7931........a..........._795090
EU155230.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet7931........a..........._795090
EU155336.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet7931........c..........._795090
EU155375.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V309/2006, complet7931........a..........._795090
EU660386.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet7931.......t............_795090
EU256098.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet7946..............g....._796590
EU256101.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V351/2002, complet7931..............g....._795090
EU256102.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet7931..................c._795090
EU256000.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet7931........c..........._795090
U45476.1HCU45476 Hepatitis C virus isolate HD-1, complete genome 7983....a..t.............800390
AF165045.1 Hepatitis C virus subtype 1b strain MD1-1, complete genome 7971......c.a............799190
AF165046.1 Hepatitis C virus subtype 1b strain MD1-2, complete genome 7971......c.a............799190
AF165054.1 Hepatitis C virus subtype 1b strain MD5-2, complete genome 7971........a.........a..799190
AF165057.1 Hepatitis C virus subtype 1b strain MD7-1, complete genome 7971...c....a............799190
AF165058.1 Hepatitis C virus subtype 1b strain MD7-2, complete genome 7971...c....a............799190
AF207757.1 Hepatitis C virus subtype 1b strain MD16, complete genome 7971....a..t.............799190
AF207762.1 Hepatitis C virus subtype 1b strain MD21, complete genome 7971..............g...a..799190
AF207773.1 Hepatitis C virus subtype 1b strain MD32, complete genome 7971.....c..a............799190
AB049088.1 Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 7983...t....a............800390
AB049095.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT167952...c....a............797290
AY587845.1 Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c7922....t...a............794290
DQ071885.1 Hepatitis C virus subtype 1b polyprotein mRNA, complete cds 7983...t..c..............800390
EF407461.1 Hepatitis C virus isolate 5004 polyprotein gene, complete cds 7963.......ta............798390
EF407482.1 Hepatitis C virus isolate 6053 polyprotein gene, complete cds 7868....a...a............788890
EU155232.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet7932....a..t.............795290
EU155302.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet7931.....c..a............795190
EU155315.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet7931........c..c.........795190
EU155317.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet7931.....ac..............795190
EU155334.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet7931...c....t............795190
EU155358.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet7931....g...a............795190
EU155374.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V308/2005, complet7953....a...t............797390
EU155382.2 Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V504/2003, complet7937...t....a............795790
EU256066.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V382/2003, complet7932...t....a............795290
EU256076.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V280/2004, complet7931....a...a............795190
EU256080.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V292/2002, complet7931.......ta............795190
AB442220.1 Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH7983...g....a............800390
GU133617.1 Hepatitis C virus subtype 1b, complete genome 7983.......ca............800390
AF207765.1 Hepatitis C virus subtype 1b strain MD24, complete genome 7971.................____798780
AF207767.1 Hepatitis C virus subtype 1b strain MD26, complete genome 7971.................____798780
D89815.1 Hepatitis C virus genomic RNA, complete sequence 7983........c.........c._800285
AF207755.1 Hepatitis C virus subtype 1b strain MD14, complete genome 7971......c.a..........._799085
AB049092.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT147952........a.........c._797185
EU155235.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet7931.....c..c..........._795085
EU256091.1 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V455/2006, complet7649...t....c..........._766885
EU256084.1 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet7937.......t.........c.._795685
M96362.1HPCUNKCDS Hepatitis C virus mRNA, complete cds 7984........a.........___800180
U16362.1HCU16362 Hepatitis C virus subtype 1b, complete genome 7984........a.........___800180
AF207758.1 Hepatitis C virus subtype 1b strain MD17, complete genome 7971........a.........___798880
AF207763.1 Hepatitis C virus subtype 1b strain MD22, complete genome 7971........c.........___798880
U89019.1HCU89019 Hepatitis C virus subtype 1b, complete genome 7972...t..c..........c...799285
AB049098.1 Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT207952......ata............797285
EU362890.1 Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c7945....g..t.........a...796585
EU155267.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V391/2006, complet7892....g..t.........a...791285
EU155271.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V401/2006, complet7908....g..t.........a...792885
EU155281.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet7931.....ca.t............795185
EU155287.2 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V320/2001, complet7941....g..t.........a...796185
EU256028.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V84/2001, complete7912....g..t.........a...793285
FJ024281.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1718/2007, comple7910....g..t.........a...793085
EU862826.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V198/1989, partial7903....g..t.........a...792385
FJ410172.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1746/2008, comple7880....g..t.........a...790085
EU862838.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V165/1992, complet7920....g..t.........a...794085
L02836.1HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome 7972....a............____798876
EU239714.2 Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet7932......act..........._795180
EU155362.2 Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet7931...g....a.........c._795080
EU255928.1 Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V231/2003, complet7912....g..t.........a.._793180
EU256053.1 Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V440/2001, complet7913....g..t.........a.._793280
D00944.1HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds 8051.....ac.a.........___806871
AB047642.1 Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 8051...t.ac...........___806871
DQ835763.1 Hepatitis C virus subtype 6m isolate C-0208, complete genome 7998....a.c.a.........___801571
DQ835768.1 Hepatitis C virus subtype 6n isolate D86/93, complete genome 7995....a.c.a.........___801271
FJ407092.1 Hepatitis C virus isolate IND-HCV-3i, complete genome 8015......acc.........___803271
AF177036.1 Hepatitis C virus subtype 2a strain HC-J6CH clone pJ6CF, complete gen8051...t.a..a.........___806871
FJ462438.1 Hepatitis C virus isolate QC383, complete genome 8760...c.........._______877361